Journal: International Journal of Molecular Sciences

Article Title: Hmgb1 Silencing in the Amygdala Inhibits Pain-Related Behaviors in a Rat Model of Neuropathic Pain

doi: 10.3390/ijms241511944

Figure Lengend Snippet: Effects of siHmgb1 pre- and post-treatment on mRNA expression levels in the CeA. ( A ) Hmgb1 siRNA AAV pooled viral vector (siHmgb1) or scrambled siRNA AAV control viral vector (scramble) was stereotaxically delivered into the right CeA of male and female rats as a 2-week pre-treatment ( A ) or 1-week post-treatment ( B ) to SNL surgery. At the chronic (4 week) phase of the SNL model, the brains were extracted and the left and right CeA were dissected out for mRNA validation. qRT-PCR analysis of mRNA expression levels for Hmgb1 was performed on left and right CeA tissues. ( A ) No significant differences were seen in Hmgb1 mRNA expression in either the left or the right CeA following siHmgb1 pre-treatment compared to scramble control for male (siHmgb1, n = 10; scramble, n = 8) and female (siHmgb1, n = 14; scramble, n = 14) SNL rats. ( B ) Hmgb1 mRNA expression was significantly downregulated in the right but not left CeA following siHmgb1 post-treatment compared to the scramble control in male (siHmgb1, n = 10; scramble, n = 6) and female (siHmgb1, n = 6; scramble, n = 10) SNL rats. mRNA expression of NF-κB, a downstream signaling molecule of Hmgb1, was also downregulated in the right but not left CeA following siHmgb1 post-treatment compared to the scramble control in male and female SNL rats. *, **, *** p < 0.05, 0.01, 0.001, two-way ANOVA with Šidák’s post hoc tests, compared to the same-sex scramble control. Gene expression fold change calculated using the 2 −ΔΔCt method, geometric mean of β-actin, Rpl3, and Rpl29 used as internal markers. Bar histograms show the mean ± SEM.

Article Snippet: A stereotaxic apparatus (David Kopf Instruments, Tujunga, CA, USA) was used to inject 1 µL of either Hmgb1 AAV siRNA viral vector of 4 pooled oligomers (serotype 5) (originally purchased as cat. #234960960215, now cat. #23496164, customized to serotype; Applied Biological Materials, Richmond, BC, Canada; target sequences: 70 CGGGAGGAGCACAAGAAGAAGCACCCGGA, 196 GCTGACAAGGCTCGTTATGAAAGAGAAAT, 365 TTGGTGATGTTGCAAAGAAACTAGGAGAG, 442 GCTGCCAAGCTGAAGGAGAAGTATGAGAA) or the scrambled AAV siRNA control viral vector (serotype 5) (cat. #iAAV01505; Applied Biological Materials) over a 10 min period, using a 5 μL Hamilton syringe for the right CeA, using the following coordinates [ ]: 2.5 mm caudal to the bregma, 4.3 mm lateral to the midline, and 7.6 mm deep.

Techniques: Expressing, Plasmid Preparation, Quantitative RT-PCR

Journal: International Journal of Molecular Sciences

Article Title: Hmgb1 Silencing in the Amygdala Inhibits Pain-Related Behaviors in a Rat Model of Neuropathic Pain

doi: 10.3390/ijms241511944

Figure Lengend Snippet: Cell type-specific effects of siHmgb1 post-treatment in the right CeA. Hmgb1 siRNA AAV pooled viral vector (siHmgb1) or scrambled siRNA AAV control viral vector (scramble) was stereotaxically delivered into the right CeA of male rats as a 1-week post-treatment to SNL surgery. For immunohistochemical studies, the brains were extracted from male rats at the chronic (4 weeks) phase of the SNL model (3 weeks after siHmgb1 or scramble injection). For each of the three cell types in the right CeA (neurons, GFAP+ astrocytes, and Iba1+ microglia), the Hmgb1 signal was evaluated by averaging the mean grey values (MGV) from each individual cell. Compared to rats injected with the scramble control viral vector, rats injected with siHmgb1 showed a reduction in Hmgb1 MGV per cell by 1.9 times in neurons and 2.5 times in astrocytes. There was no statistically significant difference in Hmgb1 signal for microglia. The field of analysis contained more neuronal cells than other cell types. ***, **** p < 0.001, 0.0001, ns, not significant, unpaired t -test. Error bars show the means ± SEM. Scale bar, 40 μm.

Article Snippet: A stereotaxic apparatus (David Kopf Instruments, Tujunga, CA, USA) was used to inject 1 µL of either Hmgb1 AAV siRNA viral vector of 4 pooled oligomers (serotype 5) (originally purchased as cat. #234960960215, now cat. #23496164, customized to serotype; Applied Biological Materials, Richmond, BC, Canada; target sequences: 70 CGGGAGGAGCACAAGAAGAAGCACCCGGA, 196 GCTGACAAGGCTCGTTATGAAAGAGAAAT, 365 TTGGTGATGTTGCAAAGAAACTAGGAGAG, 442 GCTGCCAAGCTGAAGGAGAAGTATGAGAA) or the scrambled AAV siRNA control viral vector (serotype 5) (cat. #iAAV01505; Applied Biological Materials) over a 10 min period, using a 5 μL Hamilton syringe for the right CeA, using the following coordinates [ ]: 2.5 mm caudal to the bregma, 4.3 mm lateral to the midline, and 7.6 mm deep.

Techniques: Plasmid Preparation, Immunohistochemical staining, Injection

Journal: International Journal of Molecular Sciences

Article Title: Hmgb1 Silencing in the Amygdala Inhibits Pain-Related Behaviors in a Rat Model of Neuropathic Pain

doi: 10.3390/ijms241511944

Figure Lengend Snippet: Effects of Hmgb1 siRNA pre-treatment in the right CeA on chronic neuropathic pain behaviors. ( A ) Hmgb1 siRNA AAV pooled viral vector (siHmgb1) or scrambled siRNA AAV control viral vector (scramble) was stereotaxically delivered into the right CeA of male (siHmgb1, n = 8; scramble, n = 10) and female (siHmgb1, n = 14; scramble, n = 14) rats as a pre-treatment 2 weeks before SNL surgery. Pain-related behavioral assays were performed 4 weeks after SNL surgery. ( B ) No significant differences were observed in siHmgb1 pre-treated male and female SNL rats in sensory withdrawal thresholds (measured by electronic von Frey and paw compression of the affected hind paw) compared to the scramble control. Emotional-affective responses were measured by the duration (s) of audible ( C ) or ultrasonic ( D ) vocalizations evoked by a brief (10 s) normally innocuous (100 g/6 mm 2 ) or noxious (500 g/6 mm 2 ) mechanical compression of the affected hind paw. Ultrasonic vocalization duration in response to innocuous stimulation was significantly decreased in siHmgb1 pre-treated males only ( D ); no significant effects were seen for males in audible vocalizations ( C ) or in females for audible ( C ) and ultrasonic ( D ) vocalizations. Anxiety-like behaviors measured by the center duration and number of center entries in the OFT, ( E ) and open arm duration and open arm entries in the EPM ( F ) were not significantly affected by siHmgb1 pre-treatment in male or female SNL rats compared to the scramble control. No significant differences were observed in the distance traveled within the OFT for male or female SNL rats following siHmgb1 pre-treatment compared to the scramble control ( E ). ** p < 0.01, two-way ANOVA with Šidák’s post hoc tests, compared to the same-sex scramble control. Bar histograms show the mean ± SEM. Experimental protocol figure created with BioRender.com , https://www.biorender.com/ (accessed on 8 May 2023).

Article Snippet: A stereotaxic apparatus (David Kopf Instruments, Tujunga, CA, USA) was used to inject 1 µL of either Hmgb1 AAV siRNA viral vector of 4 pooled oligomers (serotype 5) (originally purchased as cat. #234960960215, now cat. #23496164, customized to serotype; Applied Biological Materials, Richmond, BC, Canada; target sequences: 70 CGGGAGGAGCACAAGAAGAAGCACCCGGA, 196 GCTGACAAGGCTCGTTATGAAAGAGAAAT, 365 TTGGTGATGTTGCAAAGAAACTAGGAGAG, 442 GCTGCCAAGCTGAAGGAGAAGTATGAGAA) or the scrambled AAV siRNA control viral vector (serotype 5) (cat. #iAAV01505; Applied Biological Materials) over a 10 min period, using a 5 μL Hamilton syringe for the right CeA, using the following coordinates [ ]: 2.5 mm caudal to the bregma, 4.3 mm lateral to the midline, and 7.6 mm deep.

Techniques: Plasmid Preparation

Journal: International Journal of Molecular Sciences

Article Title: Hmgb1 Silencing in the Amygdala Inhibits Pain-Related Behaviors in a Rat Model of Neuropathic Pain

doi: 10.3390/ijms241511944

Figure Lengend Snippet: Effects of Hmgb1 siRNA post-treatment in the right CeA on chronic neuropathic pain behaviors. ( A ) Hmgb1 siRNA AAV pooled viral vector (siHmgb1) or scrambled siRNA AAV control viral vector (scramble) was stereotaxically delivered into the right CeA of male (siHmgb1, n = 19; scramble, n = 20) and female (siHmgb1, n = 20; scramble, n = 20) rats as a post-treatment 1 week after SNL surgery. Pain-related behavioral assays were performed 4 weeks after SNL surgery. ( B ) Sensory withdrawal thresholds (measured by electronic von Frey and paw compression of the affected hind paw) were increased by siHmgb1 post-treatment in male and female SNL rats compared to the scramble control. Emotional-affective responses were measured by the duration (s) of audible ( C ) or ultrasonic ( D ) vocalizations evoked by a brief (10 s) normally innocuous (100 g/6 mm 2 ) or noxious (500 g/6 mm 2 ) mechanical compression of the affected hind paw. Audible and ultrasonic vocalization duration in response to normally innocuous stimulation was significantly decreased in siHmgb1 post-treatment males only; audible and ultrasonic vocalization duration evoked by noxious stimulation was significantly decreased in both males and females following siHmgb1 post-treatment when compared to the scramble control. Anxiety-like behaviors measured by center duration and number of center entries in the OFT ( E ) and open arm duration and open arm entries in the EPM ( F ) were not significantly affected by siHmgb1 post-treatment in male or female SNL rats compared to the scramble control. No significant differences were observed in the distance traveled in the OFT for male or female SNL rats following siHmgb1 post-treatment when compared to the scramble control ( E ). *, **, ***, **** p < 0.05, 0.01, 0.001, 0.0001, two-way ANOVA with Šidák’s post hoc tests, compared to the same-sex scramble control. Bar histograms show the mean ± SEM. Experimental protocol figure created with BioRender.com , https://www.biorender.com/ (accessed on 8 May 2023).

Article Snippet: A stereotaxic apparatus (David Kopf Instruments, Tujunga, CA, USA) was used to inject 1 µL of either Hmgb1 AAV siRNA viral vector of 4 pooled oligomers (serotype 5) (originally purchased as cat. #234960960215, now cat. #23496164, customized to serotype; Applied Biological Materials, Richmond, BC, Canada; target sequences: 70 CGGGAGGAGCACAAGAAGAAGCACCCGGA, 196 GCTGACAAGGCTCGTTATGAAAGAGAAAT, 365 TTGGTGATGTTGCAAAGAAACTAGGAGAG, 442 GCTGCCAAGCTGAAGGAGAAGTATGAGAA) or the scrambled AAV siRNA control viral vector (serotype 5) (cat. #iAAV01505; Applied Biological Materials) over a 10 min period, using a 5 μL Hamilton syringe for the right CeA, using the following coordinates [ ]: 2.5 mm caudal to the bregma, 4.3 mm lateral to the midline, and 7.6 mm deep.

Techniques: Plasmid Preparation